Metabolic Modeling Tutorial
discounted EARLY registration ends Dec 31, 2014
BioCyc websites down
12/28 - 12/31
for maintenance.
Metabolic Modeling Tutorial
discounted EARLY registration ends Dec 31, 2014
BioCyc websites down
12/28 - 12/31
for maintenance.
Metabolic Modeling Tutorial
discounted EARLY registration ends Dec 31, 2014
BioCyc websites down
12/28 - 12/31
for maintenance.
Metabolic Modeling Tutorial
discounted EARLY registration ends Dec 31, 2014
BioCyc websites down
12/28 - 12/31
for maintenance.
Metabolic Modeling Tutorial
discounted EARLY registration ends Dec 31, 2014
BioCyc websites down
12/28 - 12/31
for maintenance.
twitter

Escherichia coli K-12 substr. MG1655 Protein: LexA DNA-binding transcriptional repressor



Gene: lexA Accession Numbers: EG10533 (EcoCyc), b4043, ECK4035

Synonyms: exrA, spr, tsl, umuA

Regulation Summary Diagram: ?

Subunit composition of LexA DNA-binding transcriptional repressor = [LexA]2

Summary:
LexA represses the transcription of several genes involved in the cellular response to DNA damage or inhibition of DNA replication [dAri85, Fernandez00] as well as its own synthesis [Brent80]. This regulation is known as the SOS response [dAri85].

When DNA is damaged, the RecA coprotease binds to the single-stranded DNA in the damaged region to form a filament [Chen08, Cox07]. This filament interacts with the LexA dimer to activate its self-cleavage activity by an allosteric mechanism, causing the dissociation of LexA from its DNA targets and the induction of the SOS regulon for the repair of broken DNA [Giese08, Little91]. The conformational flexibility of unbound LexA is the key element in establishing a coordinated SOS response [Butala11].

LexA is widely distributed in bacteria, and it appears that it emerged from the gram-positive group [Mazon04]. It shows two domains, the N-terminal domain involved in DNA binding via a helix-turn-helix [Fogh94] and the C-terminal domain involved in dimerization and in cleavage activity [Luo01, Schnarr88].

To repress transcription, LexA blocks the access of RNA polymerase to target promoters [Little81].

LexA dimer [MohanaBorges00] recognizes and binds to an imperfect inverted repeat DNA sequence called the LexA box or SOS box [Erill03, Walker84a]. Although, the majority of the LexA-regulated genes have only one SOS box, some have two or three boxes which sometimes overlap [Gillor08].

The crystal structure of the LexA-DNA complex has been determined [Zhang10a]. The DNA-binding domains of the LexA dimer interact with the DNA in the classical fashion of a winged helix-turn-helix (HTH) motif, and they bind to the same minor groove of the DNA [Zhang10a].

lexA is the first gene in the lexA-dinF operon [Krueger83]. dinF encodes a member of the MATE family of multidrug efflux transporters [Brown99].

The SOS system is induced by methylglyoxal (MG), based on ChIP-chip analysis with DNA-RNAP occupancy, and this involves LexA-regulated genes such as recAX, lexA-dinF, and dinB [Ozyamak13].

Reviews: [Butala09, Walker84a, Walker84a].

Citations: [Miki81, Horii81, Brent81, Markham81, Lamerichs89, Blattner93]

Locations: cytosol

Map Position: [4,255,138 -> 4,255,746] (91.71 centisomes)
Length: 609 bp / 202 aa

Molecular Weight of Polypeptide: 22.358 kD (from nucleotide sequence)

pI: 6.52

Unification Links: ASAP:ABE-0013241 , CGSC:558 , DIP:DIP-51082N , EchoBASE:EB0528 , EcoGene:EG10533 , EcoliWiki:b4043 , Mint:MINT-1314348 , ModBase:P0A7C2 , OU-Microarray:b4043 , PortEco:lexA , PR:PRO_000023087 , Pride:P0A7C2 , Protein Model Portal:P0A7C2 , RefSeq:NP_418467 , RegulonDB:EG10533 , SMR:P0A7C2 , String:511145.b4043 , UniProt:P0A7C2

Relationship Links: InterPro:IN-FAMILY:IPR006197 , InterPro:IN-FAMILY:IPR006199 , InterPro:IN-FAMILY:IPR006200 , InterPro:IN-FAMILY:IPR011056 , InterPro:IN-FAMILY:IPR011991 , InterPro:IN-FAMILY:IPR015927 , InterPro:IN-FAMILY:IPR019759 , InterPro:IN-FAMILY:IPR028360 , PDB:Structure:1JHC , PDB:Structure:1JHE , PDB:Structure:1JHF , PDB:Structure:1JHH , PDB:Structure:1LEA , PDB:Structure:1LEB , PDB:Structure:1MVD , PDB:Structure:1QAA , PDB:Structure:3JSO , PDB:Structure:3JSP , PDB:Structure:3K3R , Pfam:IN-FAMILY:PF00717 , Pfam:IN-FAMILY:PF01726 , Prints:IN-FAMILY:PR00726

In Paralogous Gene Group: 258 (2 members)

Gene-Reaction Schematic: ?

Genetic Regulation Schematic: ?

GO Terms:

Biological Process: GO:0006351 - transcription, DNA-templated Inferred from experiment Inferred by computational analysis [UniProtGOA11, Brent81, Little81, Little79]
GO:0006974 - cellular response to DNA damage stimulus Inferred from experiment Inferred by computational analysis [UniProtGOA11, Lin88c]
GO:0009432 - SOS response Inferred from experiment Inferred by computational analysis [UniProtGOA11, GOA06, Mount72, McCall87]
GO:0045892 - negative regulation of transcription, DNA-templated Inferred from experiment Inferred by computational analysis [GOA06, Fernandez00]
GO:0006260 - DNA replication Inferred by computational analysis [UniProtGOA11, GOA06]
GO:0006281 - DNA repair Inferred by computational analysis [UniProtGOA11, GOA06]
GO:0006355 - regulation of transcription, DNA-templated Inferred by computational analysis [UniProtGOA11, GOA01]
GO:0006508 - proteolysis Inferred by computational analysis [GOA01]
Molecular Function: GO:0003677 - DNA binding Inferred from experiment Inferred by computational analysis [UniProtGOA11, GOA06, GOA01, Fernandez00]
GO:0004252 - serine-type endopeptidase activity Inferred by computational analysis [GOA06, GOA01]
GO:0016787 - hydrolase activity Inferred by computational analysis [UniProtGOA11]
Cellular Component: GO:0005829 - cytosol Inferred from experiment Inferred by computational analysis [DiazMejia09, Ishihama08, LopezCampistrou05]
GO:0035327 - transcriptionally active chromatin Inferred by curator

MultiFun Terms: cell processes SOS response
information transfer DNA related DNA repair
information transfer RNA related Transcription related
regulation genetic unit regulated regulon
regulation type of regulation transcriptional level repressor

DNA binding site length: 20 base-pairs

Symmetry: Inverted Repeat

Consensus DNA Binding Sequence: TACTGTATATATATACAGTA

Regulated Transcription Units (38 total): ?

Notes:

Essentiality data for lexA knockouts: ?

Growth Medium Growth? T (°C) O2 pH Osm/L Growth Observations
LB Lennox No 37 Aerobic 7   No [Baba06, Comment 1]

Sequence Features

Feature Class Location Citations Comment
DNA-Binding-Region 28 -> 48
[UniProt10]
UniProt: H-T-H motif;
Amino-Acid-Site 85, 84
[UniProt10]
UniProt: Cleavage; by autolysis; Sequence Annotation Type: site;
Extrinsic-Sequence-Variant 85
[UniProt10]
Alternate sequence: G → D; UniProt: (in lexA3, resistant to cleavage);
Active-Site 119
[UniProt10a]
UniProt: For autocatalytic cleavage activity; Non-Experimental Qualifier: by similarity;
Active-Site 156
[UniProt10a]
UniProt: For autocatalytic cleavage activity; Non-Experimental Qualifier: by similarity;


Gene Local Context (not to scale): ?

Transcription Unit:

Notes:

History:
10/20/97 Gene b4043 from Blattner lab Genbank (v. M52) entry merged into EcoCyc gene EG10533.


References

Baba06: Baba T, Ara T, Hasegawa M, Takai Y, Okumura Y, Baba M, Datsenko KA, Tomita M, Wanner BL, Mori H (2006). "Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection." Mol Syst Biol 2;2006.0008. PMID: 16738554

Blattner93: Blattner FR, Burland V, Plunkett G, Sofia HJ, Daniels DL (1993). "Analysis of the Escherichia coli genome. IV. DNA sequence of the region from 89.2 to 92.8 minutes." Nucleic Acids Res 1993;21(23);5408-17. PMID: 8265357

Brent80: Brent R, Ptashne M (1980). "The lexA gene product represses its own promoter." Proc Natl Acad Sci U S A 77(4);1932-6. PMID: 6990417

Brent81: Brent R, Ptashne M (1981). "Mechanism of action of the lexA gene product." Proc Natl Acad Sci U S A 1981;78(7);4204-8. PMID: 7027256

Brown99: Brown MH, Paulsen IT, Skurray RA (1999). "The multidrug efflux protein NorM is a prototype of a new family of transporters." Mol Microbiol 1999;31(1);394-5. PMID: 9987140

Butala09: Butala M, Zgur-Bertok D, Busby SJ (2009). "The bacterial LexA transcriptional repressor." Cell Mol Life Sci 66(1);82-93. PMID: 18726173

Butala11: Butala M, Klose D, Hodnik V, Rems A, Podlesek Z, Klare JP, Anderluh G, Busby SJ, Steinhoff HJ, Zgur-Bertok D (2011). "Interconversion between bound and free conformations of LexA orchestrates the bacterial SOS response." Nucleic Acids Res 39(15);6546-57. PMID: 21576225

Chen08: Chen Z, Yang H, Pavletich NP (2008). "Mechanism of homologous recombination from the RecA-ssDNA/dsDNA structures." Nature 453(7194);489-4. PMID: 18497818

Cox07: Cox MM (2007). "Regulation of bacterial RecA protein function." Crit Rev Biochem Mol Biol 42(1);41-63. PMID: 17364684

dAri85: d'Ari R (1985). "The SOS system." Biochimie 67(3-4);343-7. PMID: 2994755

DiazMejia09: Diaz-Mejia JJ, Babu M, Emili A (2009). "Computational and experimental approaches to chart the Escherichia coli cell-envelope-associated proteome and interactome." FEMS Microbiol Rev 33(1);66-97. PMID: 19054114

Erill03: Erill I, Escribano M, Campoy S, Barbe J (2003). "In silico analysis reveals substantial variability in the gene contents of the gamma proteobacteria LexA-regulon." Bioinformatics 19(17);2225-36. PMID: 14630651

Fernandez00: Fernandez De Henestrosa AR, Ogi T, Aoyagi S, Chafin D, Hayes JJ, Ohmori H, Woodgate R (2000). "Identification of additional genes belonging to the LexA regulon in Escherichia coli." Mol Microbiol 35(6);1560-72. PMID: 10760155

Fogh94: Fogh RH, Ottleben G, Ruterjans H, Schnarr M, Boelens R, Kaptein R (1994). "Solution structure of the LexA repressor DNA binding domain determined by 1H NMR spectroscopy." EMBO J 1994;13(17);3936-44. PMID: 8076591

Giese08: Giese KC, Michalowski CB, Little JW (2008). "RecA-dependent cleavage of LexA dimers." J Mol Biol 377(1);148-61. PMID: 18234215

Gillor08: Gillor O, Vriezen JA, Riley MA (2008). "The role of SOS boxes in enteric bacteriocin regulation." Microbiology 154(Pt 6);1783-92. PMID: 18524933

GOA01: GOA, DDB, FB, MGI, ZFIN (2001). "Gene Ontology annotation through association of InterPro records with GO terms."

GOA06: GOA, SIB (2006). "Electronic Gene Ontology annotations created by transferring manual GO annotations between orthologous microbial proteins."

Horii81: Horii T, Ogawa T, Ogawa H (1981). "Nucleotide sequence of the lexA gene of E. coli." Cell 1981;23(3);689-97. PMID: 7013987

Ishihama08: Ishihama Y, Schmidt T, Rappsilber J, Mann M, Hartl FU, Kerner MJ, Frishman D (2008). "Protein abundance profiling of the Escherichia coli cytosol." BMC Genomics 9;102. PMID: 18304323

Krueger83: Krueger JH, Elledge SJ, Walker GC (1983). "Isolation and characterization of Tn5 insertion mutations in the lexA gene of Escherichia coli." J Bacteriol 1983;153(3);1368-78. PMID: 6298183

Lamerichs89: Lamerichs RM, Padilla A, Boelens R, Kaptein R, Ottleben G, Ruterjans H, Granger-Schnarr M, Oertel P, Schnarr M (1989). "The amino-terminal domain of LexA repressor is alpha-helical but differs from canonical helix-turn-helix proteins: a two-dimensional 1H NMR study." Proc Natl Acad Sci U S A 1989;86(18);6863-7. PMID: 2780544

Lin88c: Lin LL, Little JW (1988). "Isolation and characterization of noncleavable (Ind-) mutants of the LexA repressor of Escherichia coli K-12." J Bacteriol 170(5);2163-73. PMID: 2834329

Little79: Little JW, Harper JE (1979). "Identification of the lexA gene product of Escherichia coli K-12." Proc Natl Acad Sci U S A 76(12);6147-51. PMID: 160562

Little81: Little JW, Mount DW, Yanisch-Perron CR (1981). "Purified lexA protein is a repressor of the recA and lexA genes." Proc Natl Acad Sci U S A 1981;78(7);4199-203. PMID: 7027255

Little91: Little JW (1991). "Mechanism of specific LexA cleavage: autodigestion and the role of RecA coprotease." Biochimie 73(4);411-21. PMID: 1911941

LopezCampistrou05: Lopez-Campistrous A, Semchuk P, Burke L, Palmer-Stone T, Brokx SJ, Broderick G, Bottorff D, Bolch S, Weiner JH, Ellison MJ (2005). "Localization, annotation, and comparison of the Escherichia coli K-12 proteome under two states of growth." Mol Cell Proteomics 4(8);1205-9. PMID: 15911532

Luo01: Luo Y, Pfuetzner RA, Mosimann S, Paetzel M, Frey EA, Cherney M, Kim B, Little JW, Strynadka NC (2001). "Crystal structure of LexA: a conformational switch for regulation of self-cleavage." Cell 106(5);585-94. PMID: 11551506

Markham81: Markham BE, Little JW, Mount DW (1981). "Nucleotide sequence of the lexA gene of Escherichia coli K-12." Nucleic Acids Res 1981;9(16);4149-61. PMID: 6272195

Mazon04: Mazon G, Erill I, Campoy S, Cortes P, Forano E, Barbe J (2004). "Reconstruction of the evolutionary history of the LexA-binding sequence." Microbiology 150(Pt 11);3783-95. PMID: 15528664

McCall87: McCall JO, Witkin EM, Kogoma T, Roegner-Maniscalco V (1987). "Constitutive expression of the SOS response in recA718 mutants of Escherichia coli requires amplification of RecA718 protein." J Bacteriol 169(2);728-34. PMID: 3542969

Miki81: Miki T, Ebina Y, Kishi F, Nakazawa A (1981). "Organization of the lexA gene of Escherichia coli and nucleotide sequence of the regulatory region." Nucleic Acids Res 1981;9(3);529-43. PMID: 6261224

MohanaBorges00: Mohana-Borges R, Pacheco AB, Sousa FJ, Foguel D, Almeida DF, Silva JL (2000). "LexA repressor forms stable dimers in solution. The role of specific dna in tightening protein-protein interactions." J Biol Chem 275(7);4708-12. PMID: 10671501

Mount72: Mount DW, Low KB, Edmiston SJ (1972). "Dominant mutations (lex) in Escherichia coli K-12 which affect radiation sensitivity and frequency of ultraviolet lght-induced mutations." J Bacteriol 112(2);886-93. PMID: 4343824

Ozyamak13: Ozyamak E, de Almeida C, de Moura AP, Miller S, Booth IR (2013). "Integrated stress response of Escherichia coli to methylglyoxal: transcriptional readthrough from the nemRA operon enhances protection through increased expression of glyoxalase I." Mol Microbiol. PMID: 23646895

Schnarr88: Schnarr M, Granger-Schnarr M, Hurstel S, Pouyet J (1988). "The carboxy-terminal domain of the LexA repressor oligomerises essentially as the entire protein." FEBS Lett 234(1);56-60. PMID: 2968919

UniProt10: UniProt Consortium (2010). "UniProt version 2010-11 released on 2010-11-02 00:00:00." Database.

UniProt10a: UniProt Consortium (2010). "UniProt version 2010-07 released on 2010-06-15 00:00:00." Database.

UniProtGOA11: UniProt-GOA (2011). "Gene Ontology annotation based on manual assignment of UniProtKB keywords in UniProtKB/Swiss-Prot entries."

Walker84a: Walker GC (1984). "Mutagenesis and inducible responses to deoxyribonucleic acid damage in Escherichia coli." Microbiol Rev 48(1);60-93. PMID: 6371470

Zhang10a: Zhang AP, Pigli YZ, Rice PA (2010). "Structure of the LexA-DNA complex and implications for SOS box measurement." Nature 466(7308);883-6. PMID: 20703307

Other References Related to Gene Regulation

Lewis94: Lewis LK, Harlow GR, Gregg-Jolly LA, Mount DW (1994). "Identification of high affinity binding sites for LexA which define new DNA damage-inducible genes in Escherichia coli." J Mol Biol 241(4);507-23. PMID: 8057377


Report Errors or Provide Feedback
Please cite the following article in publications resulting from the use of EcoCyc: Nucleic Acids Research 41:D605-12 2013
Page generated by SRI International Pathway Tools version 18.5 on Mon Dec 22, 2014, biocyc13.